![]() |
Humor, in blog format (you know you wanna rate this...) |
I happened to come across an interesting fact as I was flipping through my Genetics book and scrawling down incorrect answers in an attempt to finish the assignment on time. Did you know that potatoes have 48 chromosomes? That's right. Forty-eight. (oh, and in case your memory needs refreshing, humans have a grand total of...drumroll please!... 46 chromosomes.) As I read these words, I felt anger boiling in the pit of my stomach. I've been trumped by a fucking potato, I thought to myself. And I don't even like potatoes. French fries, yes, but not potatoes themselves But never fear, my fellow Homo sapiens, for I've already devised a simple plan to solve this dilemma. I'm going to introduce 4 new chromosomes into the human genome. Because, if you think about it, the coding possibilities are pretty much endless. Why, with just a few short sequences of AGTTCCAATCTTACGGGTTACATCATTGGCAAAATGGCATTCAA, or maybe GGTTTTTTTTTTGGGGGGAACCGTACGTAAACCCCC, I could make a human with an extra pair of arms, or a third leg, or toenails that trim themselves, or stainless-steel teeth, or glow-in-the-dark skin, or transparent eyelids, or feathers, or,...or... Well, you get the idea. |